Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00040

VK Genotype FlyBase Record BDSC Stock #
VK00040y[1] w[1118]; PBac{y[+]-attP}VK000409755

CytoSite Location (R5) Strand
87B103R : 12440193-

Flanking sequence(s):
VK00040-3TTAAAGAAAAAAAAACTGCCAAAAAACTGTATTGCGTTTATGATGCAACT
GTTCTTCGTTATTAATCATGAAACATAAGAGAAGTTAAAATATGAAACTA
GATAATTAGCAAACTAATCTCTGCTCTCAGTAAGAGTATTACTAACTCGA
ACTTATTAATCAGATTCCAATTGGAGTCCGG
VK00040-5AACAAGGGTTTTTTGCAAAGGTTTTTTGTTTTTTTTTTTTTTAAATTCCA
GAAGATGAGCTCAAGTGACACGCGAATTGTATCCAAAACTTCTATCTAAT
TGCATATTTATGTCAAACGCAATCGACTACGAAATACCCAGACGAATTGC
TTGCGACAAAGAAAATGCACAACGAAGCTTTAAAAGATTACCTCACAGCC
TTGACACCTGGGTCACTCAAATATTAACTAAACTTTTAAGGTACATAACT
CAGAAAATTTTCTTAAACAGCAATAATTCTATTCAGAGGTCAGGAGTTAA
ATTGTTACTAAAAAGAAATTAAACTTGTAATGGACTGCGTTCTAATAATT
AATACATACAAACATATAATAATATATGTACAACTTTTTATGTACATCCA
TAAATTTCTGTATCAAACAACAAAGTTTTCGTAGTGCGCAGTTAAAAAAA
CGATGAGCCTTAAATCTGTTGAATTGTGTGCGTTCGAACGGAAATAATCA
TAGAGAAATTTTAGCAACCTTTTAATCTCATCACCAGATGCCACACATAT
ATGTATGGTAATTCTGGGGACGTCAATATAATAAGAACAGAATCGTTAGT
TTTCAAAGTTCATCACTGACATTCAGCGACCCTAAATGTGTATTTACTAT
TATTAA