Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00039

VK Genotype FlyBase Record BDSC Stock #
VK00039y[1] w[1118]; PBac{y[+]-attP}VK000399754

CytoSite Location (R5) Strand
67E43L : 10505700-

Flanking sequence(s):
VK00039-3TTAAATTCAAACATATCAGTTATCTTTTGTTTATATAAAAAAACACCTGT
CATAAAAATTCATTCGCTGCGACGAACAGAAAGAGGACTCGAAATGGAAT
AGGAACATTTCACAAAGCTAAAAAATTAAGCAATTTAGAAAAGCACTTTA
TACTCTTACAATAGGTGTTTTGAAAGTTGCAAAAAAGTTGGCGAAATATG
AACGAAGTATATTATTTTTGATC
VK00039-5CCGGGTGGGCGTTTATAGAGTGGGCGGGGTGACCTCTGGATTTTAGCACT
TTATTAAGGGATTTTGATTCGTCCTCATTTCTTGTTTATGTTTGAGTTCC
TGGAAATGAAAAGACAATAAGAAATGAGTATTATTTCAAAATAGATTCTT
TTATTTGTTGATTGCTAATTTTTCTGGTCAATTTTTTACATTAGATGGAT
TACAACATTGCAGATTATTAAGCATTCAGTTATATTTTAGGAATTTATTA
AAAATCTGGTTTCTGCAGTATTTAATGTCGGCAAAAGTAGACAGCTAAGT
TCATCATAGAAAACCTTTGAAACATAATTGAATTATAAAACAATAAATGC
GAGCCACAAAAATCCCAAAACATGTCTTATTCGTTTTTACCTTAAAAAAG
CGCATGCTGCTAATTTTCTCAACATTTGTATGATTTATTTCATTTTATGT
TTTCGCTGTTCACTTTGTTTAA