Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00038

VK Genotype FlyBase Record BDSC Stock #
VK00038y[1] w[1118] PBac{y[+]-attP}VK000389753

CytoSite Location (R5) Strand
5B8X : 5757560-

Flanking sequence(s):
VK00038-3TTAAGCGTCAGATTGACCAATCCAATCATTCGATCGAATCCGAAGCCAAT
TGATTAATTCCAAAATTGTTATAGCATCGCCGTACTATCAGGGGATTGAA
CATCAAACTGCAATTGCCGCCGG
VK00038-5CCGGAACGGCTAGGTAGCGATACCGCAACTTCAGCCACTTGGGATAGATC
TGTTCCGCCAGGTGCTTGTGGCGCGCTGGAAGGGATTCGCGCCACAGGTG
AGTGCGCCACGAGTCCAGCGATGTTTGCGAGTTATCGGGACAGCGGCGGA
AGGCCTTTAGAAAGTTTTGGGTGGCCTGTGTTGCGTCATCTTTGCTGAAC
TGGTATTGGGTCTCCAGAAAATCAGCGAGCTAAGAACGAAATTGGAAAAG
GGTTGGCAATTCGCATTATTATTGCGTTACATAAATTCAAAAATATACAA
AATTGCGTAGATGTGATAGTGCCGTAAAAACCTCAACCGCGATAAAACTA
TAAATACGCTATGACGAATTAAAGACGAGATAAGTTAAGAACTTTCACGC
AATAAGAAGTGAACAACCTGAAAGTAGAGTTAATATTAATAAAAGCGATT
AGAAGCCTCAATACGTGCATAATCTTTTGCGAAACGCGGTAGAACGTAAA
TCAAAACTATTACGTCCATAAAGTTCTCAATTAA