Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00037

VK Genotype FlyBase Record BDSC Stock #
VK00037y[1] w[1118]; PBac{y[+]-attP}VK000379752

CytoSite Location (R5) Strand
22A32L : 1582811+

Flanking sequence(s):
VK00037-3AATCAATAAATTACAGTAAGCCACCACCGATATTATTCACTAAAATCACT
TACTTTATTTTCAGGTGAGTCTGCAAACTTTTAAGTCGACAAGTCATTGG
ATCTTGGGAATACGCACAGAGATAACAGACTGCCGCAATCAAAGTTGGTT
ATGGGGTAAGTGAGACGTGGAAATTGGCTCAACAATTTGGCTCAAGCTCA
ACACTTTCCCCCGCCGCCTCCCCCATTTTCCGCCCACTCCAAGTGTGACC
TTCAAAGAGCGACAACAATGGCGCATCTTCTCCCATGTGCTTTTTACCCG
G
VK00037-5CCGGAGTGTTTGTGTTTGCTTATGTAAGCTGCCTTGCTGAGCTGCGATAT
TGATTACATTTTTCACCAGCTTTGAATATCTGTTCATTAGACTGGGGTTT
GATTTTTTGTAACATCTCACAATTTTTGTACACATTACAATTTTTTTCGA
TCAAATATGGCACATATACCAACGCTTAAAGTGTAGGATATACATATACT
TATTTAGAACAGTTTTTTGTTGCTCTTTGACAGTTAAAATAGCATTTCGC
TTTTGGCCCTTTGATATTTAACTTATCGACCAGTCAATTGTAAACTTTTC
CCTTACCAATATTTGTACTTTTTTCGACTTTGCTCAACACACAATTGCTC
AAATTATTTGTCTTTTTTATTTGTTTATCACCATTTAGTTACAAAATAAG
TTTTCTAAAAATGCTGAAATTTTGTCACAAAACTTTTCCTGGCATTGTTT
ATTTGGTTTATGGGTGGGAAAAACCCGCACAAATGGAAATGCGGGTTGAA
TAGTTTTCCTAGTTCTCTTTAA