Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00036

VK Genotype FlyBase Record BDSC Stock #
VK00036y[1] w[1118]; PBac{y[+]-attP}VK000369751

CytoSite Location (R5) Strand
70C43L : 13853949+

Flanking sequence(s):
VK00036-3TTAAGATGACGATCTGGATCTGGTATCTGTGGTTCCCATTTACCCTGTTA
CCCTAACACCACCTCTACAATGTTCTCCAGAGCGGTAGGAAATCTTAATC
TCATCATAACTAAAACACTATTGATATCGAACTTTTCGTGTTCAGCCTTA
TTCCCAAGATTGAAAACCCTGCACATTCACTGCCCGATAGCATTTTCAAT
GCCAGTTCTCAATTGGCGCCTGAACATGGCCCGAAAATGGCTCGTCTGAC
CAAAGAACAACCGAGGGGCAGCTGGTCACCTAGCATTAACGATCAGATGC
AGTATCTGGAACTAAACTTTGCGAAGCCAGAGCCATTCTATGGTGTGGTT
ATGGCTGGTAGCCCGG
VK00036-5GATCAAACCAAACTGTGGCTTGAAACCCGAACCAGAACCGGAATTTGAGC
CCATCAAGCAATGTCCACCAGGCAAAATAAAGTCGGAATGTGCCAATCAG
TGTGAAAATACGTGTCATTACTATGGCAGCATTCTAAAGAAGAGAGGTCT
CTGTCAGGTTGGTGAACACTGTAAGCCTGGTTGTGTGGACGAGCTGCGAC
CAGATTGCCCCAAACTTGGAAAGTTTTGGCGCGATGAGGACACTTGCGTC
CATGCTGATGAATGTCCTTGCATGGACAAGGCGGAACACTACGTTCAGCC
GCACAAACCCGTCCTTGGAGAGTTTGAGGTGTGTCAGTGCATCGACAATG
CGTTCACCTGTGTGCCCAATAAACCAGAACCAGTTCCCAAGGATGAAGGT
AGGTGGTTTGTTGAATATATGAACCTCACATACATTACATATTTTCTCTT
TTTTTATTTAA