Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00033

VK Genotype FlyBase Record BDSC Stock #
VK00033y[1] w[1118]; PBac{y[+]-attP}VK000339750

CytoSite Location (R5) Strand
65B23L : 6442676+

Flanking sequence(s):
VK00033-3TTAAGACGACATCTTCCTCGAGATCGGCGCGTAATGCGAGCGAATTATTA
ACAACGTTCTCCGCACGAAAACAAGCTCAAAGCCCCAAGATACCCCCGG
VK00033-5GATCAGGTGTATAATTCCCCAAACGCTTTGCTTTCTCGCTGATTTACCGG
CTTGGGTTTCGAATTAATTTTAATTACGGCGAGACAGAGAAAGGCAGCTA
TTGTTGCTGTCTCATCAATTCGCGACCCCAGCGGAAATGGCAAGAAACAA
ATTTGAGGAGGTGGAGCGACTTCGGCTTGAATCGCAGCAAGTGAAGCATT
TCGGTTTTGGGTTTTTGGCACTCTCTGGCAATTGAGCGCGAACTTCTTGG
CGGACTCCTTTCTGCATTTGCCATTGCCTTTTTGGCCTGCTTTGGTTGCA
CTTTTCCCCTGCCACCTCTTTACCCGCTGAATGCGCTGTGTTTTACTCAA
TATTAATGAAGTCATTAA