Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00032

VK Genotype FlyBase Record BDSC Stock #
VK00032y[1] w[1118]; PBac{y[+]-attP}VK000329749

CytoSite Location (R5) Strand
85A23R : 8475341-

Flanking sequence(s):
VK00032-3TTAAACTCGCCCGCTTATAAATGTATTCGGCCAACACACTCACATGCCGA
TTTTACCTTTTGTTGCTGCTGCAACTAGCCAAGCAGAACGCCTCGGCGTT
ACGTTGGATTTTATTCCACTTTTGGTTCACTTTCAGTCAGCATTTAGTGC
ACTGGAAAAAATGAAGACCAAGTGCTGGTCAATCAAGAAAACATCTAAAA
TTTGCTTATTTTATGGCACCAGTAGATC
VK00032-5TTACATAGTAGTGCCGAGAAGGCTTACAGCAAATCGAATTAAAAATTTTT
GCAAATTAAATTGGTCTTTACAATGCCAAGTAGAAGTCTCAAAAATGACT
TATCTGCAAATGAAAACGAATGAAAATGTTTAGACTTGCCAAATTGTGAA
ATTGTGAAAATGGAGAACGATTCCATGAGTGTGTGTGTGTGTGTGTGTGT
GTGCGGGTGCAGAGGAGCATTAAGTGGGGGAAAGGGGCAAAAATTAGTTT
TGTTTTGGCGAGTGCGATTGTGGAGTGGACCAAAACACAAAGCCTAGTTC
GTTAA