Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00031

VK Genotype FlyBase Record BDSC Stock #
VK00031y[1] w[1118]; PBac{y[+]-attP}VK000319748

CytoSite Location (R5) Strand
62E13L : 2395487+

Flanking sequence(s):
VK00031-3TTAATTGAAGCCCCTCAGGGGCAAGTTCGCTGATGTATCTTTAGTGCCGT
CCCTTCTATTCGATGATGTCGGCTACTTTTATTGTCAAACAAACAAACAC
CAATCGATGACACTCTTTGGAAGTGGGGGCTTTAAATAGGTTTAAGCCCG
G
VK00031-5GATCTAGAAATTAAATTGATTTAAAACTCTGAATCGCAGCAGTTTTCTTT
AGCCGTTTCTACTTTATTGCACAATTGTTTCTGCAGTTTTTGAGCTCGTT
TTACTGTGCAATTTGCTTTCATTGCACTTTTCTGTGGCTCACCACCAACA
GTTTGTTATGATAAATACGATTTCTTTTAAAATCCGATTAAAATCAACTG
AATCCATATTCGTTGCTCAATGCACTTATATAAAGAAAACAATTTTCCTT
CCAATTTTGATTGCTCGTCGGGGTTTCGGTTACTCTTTCTCATCCATTTC
GGCTCATAGCAATAGTTACCAAATCCAATTAAGTTCAATAACAATTTGGT
GGAAAGGAAGAAGAAGAAAAAAACAAACAAAATCAAATGGGCTGCTCTTT
AATTACTCGGTTTAGCCCTTAGTTTATTGCTCTTTATCGCAGTCCCTGTG
GTCATTTGGCCATTTTGTCATTTAA