Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00030

VK Genotype FlyBase Record BDSC Stock #
VK00030y[1] w[1118]; PBac{y[+]-attP}VK000309747

CytoSite Location (R5) Strand
50E12R : 14138559-

Flanking sequence(s):
VK00030-3TTAATGTGGATGCGGCTTAATTGTTCCAAAAGATC
VK00030-5GATCCAAGAGTTGGGTCAGCGGCTGCTTTTTGTCTCGGTTACTTAA