Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00029

VK Genotype FlyBase Record BDSC Stock #
VK00029y[1] w[1118]; PBac{y[+]-attP}VK000299746

CytoSite Location (R5) Strand
Het3L : 27169029+

Flanking sequence(s):
VK00029-3TTAAAGATTTGGGTGTGGATGAGTGTGACGGACGAACCCTCACCTAGAAT
TTTAACAATACGGAAATTTGTGTTATCCAAATGCCGATGAGTGCGGAGCA
GCTTAGCGATCTGCACGGAGGATTCTTTGGAATATATTGCCCATTTTAGC
TTAAGTTAGCCTTGTCCACCAGCTCTTCGTGTTGTTTATATGGGCCTTAA
CTTCGCAAGCTTCCATCGTCGAGTAAATATTCCACCCGG
VK00029-5GATCGCAGTTCAGTTTAGGTGTCCTCTGCCGATAGCGTTTCCCGTGGAAT
TGATTTGTTCTATGAAAACGTTTGCTTTATTTCTTTGTGAAGATTGTTAC
CTAAATGGCTGCAACTTTAAGCAACACGCCTCGGTATTGGCTTTGTAGCG
TCTATCCCAGTCGGGTTTTCGATGCTATGGGTTGGTTCCGTGCTTCTTTG
CGTATCTTTAGAGGCACTGCTAGATTTCAGTTGTTTGCGTAAATGAAAAT
GGTTGAACGAGCGTTCTGAATCTCCGGTTCTCTGGGCGATGTGGGGCATG
TCGAGTGACTTCATAGGCAGATTGTGGTCTACGCTGTGTACGCCCCGCAA
CTTGTACTTAGATATTTTGTTAGATATGTTAAGTAAGGATATCTCCGATG
CGTCGACAGTGTGCGTAGTGTCGTTTGTCCACCGTAGGCATAATGGTAGC
CTGACACCCTTTACGTTAAGATGCTTAA