Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00028

VK Genotype FlyBase Record BDSC Stock #
VK00028y[1] w[1118]; PBac{y[+]-attP}VK000289745

CytoSite Location (R5) Strand
92F13R : 20549650-

Flanking sequence(s):
VK00028-3TTAACAGTGGTTAAAATCATTAATTTTATAGATGAAAGGGAGATACAATA
TAATATTGTACTTTATTCAGAATTGTATTTACGGTCTGAGAAACTATATT
TTACATTTAAAGTTCACCCTGAATTGAAATAAAGTAGTAATGTGGCTTTT
ATATATTGAAAATATATTGTATATAGATTCGAATGAACAGATATACTCTA
AATGCCACGATACTTAAAACTATAGGGTGCTCAAAGTTCGTTTCCCCAAT
TAGTTCTTCTATATCGTGTTGGAACTCACTCCCGTCAGATTTGAACATAT
GTATTTATGCAGCAAAGTTTATCGCCACCAATCCAGTCCACCACATGTGT
TTAAAGTTATTTCTGGATC
VK00028-5CCGGCTGGCTTCTACCACTTCGGACAAATTACGATTGTCAGCGATGCCGA
CGTTAGCTAACCCCTTGGCGTTTCACATTTGATAAACCCGATCGCATTGC
TGTGGACACCGTAGATTATCATTGGTCATAGTGGGTCCTCCAATCAATGG
CCAGGTGGACGGTCAACTTACATAGGTTAGTTGGCAGAGGGGTTTCTTCG
TTTATGTCAACTAATAAAACGCATACATTATATAACTACCATTATTTATT
AA