Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00027

VK Genotype FlyBase Record BDSC Stock #
VK00027y[1] w[1118]; PBac{y[+]-attP}VK000279744

CytoSite Location (R5) Strand
89E113R : 17052863-

Flanking sequence(s):
VK00027-3TTAAACGTGTAAGGAACACAAGATCACGTCCAGATTTTTCACAGTGCCAA
GCAGACGCTCCAGCAGGAACCCTGGTTCGTCAGTTCCAGCAGAAATACAT
AATTGTCTCTCGTTTGGACGACTCGAAAACACAAAAGCAAATAGGCTCCC
GTCATTACGATAATAACAGGTCGGGAACAGGGAACACAGGCCACTTGTGG
AGTGAAACCGG
VK00027-5GTTCATCTATGACATACAGTACAGTGCAATACAGTGGCAATCTACGAATT
TAGTTATTGTAGTTTATTGTAATTTAAAACCGGTATTACTTAA