Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00026

VK Genotype FlyBase Record BDSC Stock #
VK00026y[1] w[1118]; PBac{y[+]-attP}VK000269743

CytoSite Location (R5) Strand
96F33R : 25847068+

Flanking sequence(s):
VK00026-3TTAAAGAACACATTTTGATTTATAAGTGAATTTCATACATATATTATGTA
TTTAGTTCTATCATTTGTCTAGTTTATAACACCAAAAGAAAATACCTAAG
CTTACTGAATATGTAATATAATATCTATTTAACAAACTTTTGTCGTGGAA
TCTGACCATCTTGGCCAATTGTATCTCAGCACTGTATGGCCAAGGATAAT
GCCACGTAGCATATATGTAGTTGCACTTATGCCACTTTACACCTATGCAG
GTGTGAAGTATTAATTTCCAAGTTGCCTCCTTTTTTTGCAACACTTTTTG
TTGACATTTGTGACACTTTGTTGTCTTGTTTGTTTTAGTTTGTATCGCGA
CCAGTTCTGCGTTGTTCTTCTCGTTTTCATTATTAATACGACAAATGCCT
TTTGTCCCACATTCCTAGAAATCCAAGCCAAGTTGCCTCGCTTTGTTGCC
GTGTTAGTGTCAGAAATTATTCTTGTTGACATATAAAAATTGTTTAACCC
TTTTTTTCGTGGCATGAAAAATGACAGAAAATGATAAAATGCTTTCGCGC
GTGAGTGTGAGAGTGAGGCATTTGGCCAAAACATTTCCCAGACATTGATG
TATTTGGGTCAGATGCTGGCCGG
VK00026-5GATCTGTGAAGGTCATCGCTAAGTAGTTTAGTTCTGCCATTCGCATGCTC
AGCAGTGCAAATGCCTTGATAAACGTTGCAATTTTATAGCTCACAGCATA
TTTATTTCGCTTAGGAACTTAATACAATGAAGGCGGGGACGTCTTTGTTG
GCTTCCCCCATTTTGCTTCTCAGCTGGCATTGTTTTACTTGCCAAGTCTT
TCAGCTGCTTTGTAAGGAAATTTGCTTATTTATTTGTTAAACTTGAAATC
CCTACCGAGGAAGGGATGCCTTAAGATGAAATACTATCGACTCTACAGAA
CTCTCAAGTGCTGCAAATTAAGTTAACAAATTGTAGCCAGGGGTTGGTTT
TATCCCGATTGCAATTAAATGAATATATAGTGCATAGAACGGAATCTCTC
TTATTTAA