Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00024

VK Genotype FlyBase Record BDSC Stock #
VK00024y[1] w[1118]; PBac{y[+]-attP}VK000249742

CytoSite Location (R5) Strand
101F14 : 58505-

Flanking sequence(s):
VK00024-3TTAAAACGTTTCGAAAGATTTTTATTTTTATTTACATATGTAAATATACA
TATGTATATAAAACCGTTCAAAGGCATTCGAAGAGCATATGTACATACCT
ATATTGTAATAATGTTCTAAATAACATTTTTTTTTACATACTTAAATTAA
AAACAGAATTTTTTTTTAAAGAAAGGATGTGGCTTTCTTAATGTTCCTTA
TTATTATTGAAATAAACTGGGTATACAAACTTTTTGAATCTTTTATTTTA
TATTATAACCACTACAAGTACACGGGCGAGAAGGCATTAAAGTATAGTAA
CATAATATAAAATATACTATGGTATTTATACAAAAAATTTTGTCATAACA
AATATTTGTTCGGTATAAAATATATGTACATATATACATACGATGCAAAG
TATATAACGGCCACAAACTGCCGAAGACTGTCACACCCTTTTAAAAGTGA
CTTTTAAAAGTGATGTACCAAAAAAAAGTCATACCCACTTCGAACGATC
VK00024-5AGCATAACTTTAATAAATAAATTTCTTCGTATAGACATAAATATATGAAT
GAATGAACATATATATGAATATGAACATATAAATACAAATAAATACATAT
AATACAAATAATACAAATAAATGTATATGTACGTGTTCGTCAATGGACGT
ATCAAAAAGTATTTATGTATGTAAATATAAGCCCTGTAAATCGTAGCATG
AGTTAATATTAATTGAGCTGCATAATATAATGTGAGCTGCAATTTCTTTT
CTAATCTCTTACATATGTACATAGCTTTATAGTTCTTTGCTTAA