Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00023

VK Genotype FlyBase Record BDSC Stock #
VK00023y[1] w[1118]; PBac{y[+]-attP}VK000239741

CytoSite Location (R5) Strand
70A23L : 13213019+

Flanking sequence(s):
VK00023-3TTAAACGACATATACTAAAATTGTTTTAAAATAAATTGTGTAAGTAAATT
GCTGCAGGTCCATTTTAGCGTAAGGTGAAAAGATTTGTTAAGCTTCTATT
ATCTTAGTATAAATGAAAAAATAAAAATATTATATTGTTAGTTGTTTCAA
AATCTCGTTACATTTACTTGTTAAATTTTAAATTTTCTTTTTTATTTAGC
ACTAATTGTTTCAACTAATCGGTATCTTCCTATTCGAATTCGCTTTAAAG
TTTAAGCTCTTTTATGATTTTACTGACAAATATGTACATCACAGCAGATG
GCGAGGGGCTGAATAAAGTCTGTGGTTTCAGCACCCGG
VK00023-5GATCTCTTTCGCATTGTAATAATATGGCACTCAGCCCGGCCCCTTCTCAT
TCGCCATCCCATGTATCCGATTGCAGTCCATAACAGCTGGAAGCACGTAA
ATCTCATTGTTTCGATGCGTTTTGCATGCGTTTGAAGTGTCTGGTTGTCG
ATTCCGATTTCGATTTCAATGCCGGCGTCTGCCCCAATCCTCTCGCCCCT
CCGCCCCTCACCAACCTCACAATCGCCATCACCCTGCCCCAAGAAGCCTG
CATTTGAAAGCCTGCCTCCGCATGGGTAGTTACTTTTCGTAAACCATATT
GAGATACCCATTGGCAAGAAGAGGTCAAGTGCGCGGGTAAATGTTTTAAT
TAA