Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00022

VK Genotype FlyBase Record BDSC Stock #
VK00022y[1] w[1118]; PBac{y[+]-attP}VK000229740

CytoSite Location (R5) Strand
57F52R : 21645971+

Flanking sequence(s):
VK00022-3TTAAAATAAGCTGAATTCACCCACAACTGCGCGTTTTCTTCAGTGTTCAA
AAAGTATCTGGAGAGCGCATCGGATC
VK00022-5CCGGAATTTTTATGGCCAAACAGTGGGCAGTAGGCGTTTTGCAGATTGGG
AGGAAAAAACAGTTTACCAAAGAGACTTTTCATTGTTTATTGTTTTTGTC
GAAATGGGCAATTAAATTGGTTTCTTGGAATTGCGGATTGGATATTCAGC
TTAAAGCGGTGAGCTCTATTAATAGAGTTCATCGCATCCACTAGGAACCT
TTGTTGACCTACTAAATGATATAGATACAAACACAGGACACTCCAAAGGG
AATATTGAGAGAGCGCGCGTGTCCTGTGACACTTTGTCATCTATATTCAA
ATCCGAGAAAAATCAGTTGGGAAATAAGAAAACTTATTTTTGAGCTGGGA
AAAGAACCACTATCTCGAAGAAGAGCGCAGCACCCACAGAGAAAAAGAAG
AGAAAAAGAGGGTGCGTGGGAAAAGAGAACTTATGCGCGTAGAAAAACTC
TTGGTCGTTAGTGTAGAAAAATATGATCATAATTTATAAATTTTAATCGA
TTTGTGTGGGTGCCATCCAAGTTTAAATACTTCAAGCCTTCAATATGTTC
AAATTCGTTCTTAATATGTTAAGCATAGTATTTTATTACGATTTTAA