Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00021

VK Genotype FlyBase Record BDSC Stock #
VK00021y[1] w[1118]; PBac{y[+]-attP}VK000219739

CytoSite Location (R5) Strand
76C53L : 19794506+

Flanking sequence(s):
VK00021-3TTAACTACGAGCAAACAACAAACAAACAAAAACAAGTTAACACATATGCC
ATTTTCAGGTCCGACTGTTATTCACTTTAGGTTTGAGTACAATCAAAAGA
TTTATTTTAACTTTGTTACGTATATTACAAATTTAATTATAAAAACCCCT
TTTAATCTGTTATTAAAGCTGCAAGTGGCCACTGTGGAAAAAGGTTAATT
AAATGAATTAATGTGATTATAAACATATTAATATTTGTTTTTTCCGGCAC
CAACATACTTGTCCCACTGTTGTTATTGCGCCGCATAGAACTTTAATAAA
CAATCCTCAAATGTACAAACATACATACATAAATATGCACATACGTGGGC
CCGCCAGTATTTAATTACGAACCGTTTTTGTCTCTTTCATCAGCAGCATT
CGCAATGGACACGACACTGATGAACTTAATAGACGCTCCGCTGGACGAGT
CCATGGATTTGTTCAAAGCGGAGGATGTCTTCGAACCGTTCGACGCCGAC
CTGCACTCGGACATGCTGGACATCATCCTCAACGATATGGACCTGGCGCC
GACGCAGATGTACAACATGCTGCTGGACGAGCCTCGAACGCATACCCAGC
AGACGCAGTCCGTGGATC
VK00021-5CCGGTCGCGTATGTGTGTGTGCAGTGCACAGTGGGCCAAAAGCGAAGTAA
AAGCTTAGACCGTTTTAAAATATTCGCCTCTATTGCAATTTGCATTAGTC
TAGCAAAACTTGATATCGCCAAAATGATCTCAAGATATTATATTTTGTTC
CTATTTTAA