Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00020

VK Genotype FlyBase Record BDSC Stock #
VK00020y[1] w[1118]; PBac{y[+]-attP}VK000209738

CytoSite Location (R5) Strand
99F83R : 30553313+

Flanking sequence(s):
VK00020-3TTAAATAAATATGAAATAAATGGCGCGAGTTGTTGTCCGCTTTGCCCATA
TAGCCGTTCGGATTTTCCCGCATTTCCCTCTCTTTCGAGTGCTTTCCCGA
CCTTCGACAGCTGTCGGCCAATGCCAAGTGAAAAATTGACTGTCGGCTGT
CTTAAGCGATTTTCGATGGCAGATC
VK00020-5CCCTCGGCCCGCCCCCTCAACTTCCGCGCATCATTTTCCTCAGCTGACTT
GACTTTGGTAAAGAACTTGTCGCTGCACAGATCAAAGTGGGCAGGCGAAT
GACACAAAATAAATATTAA