Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00019

VK Genotype FlyBase Record BDSC Stock #
VK00019y[1] w[1118]; PBac{y[+]-attP}VK000199737

CytoSite Location (R5) Strand
68D23L : 11697108-

Flanking sequence(s):
VK00019-3TTAATTCAGCATAAGAGGTAAAATTTAAAAACGTCGAGTGCTTTTCAACA
CTTTTTAGTTTCAGTGTTGGATAAAACTGCTTCTAGTTCCTTGTTCCGAT
C
VK00019-5CCGGGAAAGCAAGCTGAAAGTCAAGGCCAACCATGGCCAGGATCAGGGAG
ACACAATGATGGTCAACGGAAAGATCAATATGGCTCCGTTTGAGGCAGCC
TGCGAGCAAGCTGCCTCGGAATACTTTGCGGCCGTGGAACAGGAACGCCA
AAGGCGGCTGCCAGGCGGAAAGCGTAGGTGAACGAAGGCGGTTTAGAAAT
GTATACCCCTATTACGGGAGTATCCACTAATTTGTGTTCTTTAATCTTTC
ATTTCAGAGGATGCGGAGGAGGCTGATGTGTCCGAGGCGGAGAGCTCGAA
GCTGTAAATCCCAAACGGAACTATGTCCTTTTTTTGTTAAATCTAAAGTA
CAAGTTAAAGGGAATTTGTATAGGAAATAAAAATATAGTAACCACTTTTT
AAAAAACTAATTAA