Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00018

VK Genotype FlyBase Record BDSC Stock #
VK00018y[1] w[1118]; PBac{y[+]-attP}VK000189736

CytoSite Location (R5) Strand
53B22R : 16298211+

Flanking sequence(s):
VK00018-3TTAATATATATAGATAGATAGATAGAGAGATAGATAGATAGATAGATAGA
TAGATATATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA
GATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA
TAGATAGATATATAGATAGATATATAGATAGATAGATAGAGAGAGAGAAA
GATAGATAGATAGATAGATAGATGGATAAATAGATAGATAGATAGATTCC
TATGTATGATGGTGGTAAACTTATACTTACACCCATATCATACACTATAT
GATGTTTTTATCAATCAATTGTCATCCTTATAACGTTATATGCCTTTGTT
ATTTGGCTACATTACACAAATGTTCAATAAATTTAATTATACTATGCAAT
TTTCAACTAATGCTAATAGATTTTCCTCGGTGTAGATAAACGCATTGGAG
TGGGGCGACGCTGATGGCTCAAATGGAAACATTTCGCGAGCCTTGTCAAA
CAATCGAATTTAATTTATGATTTCCTGCGCCAATCGAGTAATGACACTGC
ATGTGGTAGACCCCGGCGGACCCCGAATCTCTGAATATCTGGTGATC
VK00018-5GATCCGGCAGAGAGAAAAAATGTATTATCATTTTAAAAGAATATTGAAAT
AGTTTAACCATAAGTTCGACAATTGATAAGATAATAGATTCGTTAA