Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00016

VK Genotype FlyBase Record BDSC Stock #
VK00016y[1] w[1118]; PBac{y[+]-attP}VK000169735

CytoSite Location (R5) Strand
47C62R : 10899614-

Flanking sequence(s):
VK00016-3TTAAAGACCACTTCCCGCTTACACACAATTGCACATGTCCCCATGACATG
CACTGCGCTCAAACTATTAGTACCCCTTAGTAACTTAAGCCAAATTAAAA
ATAAGTTCATTAATATAAATAAAATAGTCAATTTCCACTGTCCCGATTGA
ATAGAGAAACTTTATTTGTAAATTTTAAATGTCGCCAAGGAACTCGCTAG
ATATACTAAACCAAAACCGATTGTAGCTCCCGAAATCGCAACCATAAGTG
GAATAATTAGATGCCAACAAAGGCTTTGTTTGCTTACTGAATAAAGGTTG
TCGTAATTTGATTTCTGTGTAATCTTGCACGAAACGGAATCATTACCTCA
GACATAATTTGCCTGCAATTGCGGTGGTGCACTTGTCTCGTGCAAGCGAA
AAAATCAGTGCTCGAAAAAGCTTAGTGGATATACTCGTACATATACTATG
AATCGTTTAGAGGGGTAGGTAAATCAGCGGGCTGCGTTCGAAATTTATGA
GTGACTCTGCGACGTATTTATCTTAAGCCATCGTCAGTTGCATATTTTAT
GGCTATTTTAAACCACTCAATGTGGTAATCGGGCGATAATCATTTAATAG
TCGAGGTCGACGGTATCGATAAGCTTGATATCTATAACAAGAAAATATAT
ATATAATAAGTTATCACGTAAGTAGAACATGAAATAACAATATAATTATC
GTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAATCATGCGTCATTTT
GACTCACGCGGTCGTTATAGTTCAGAATCAGTGACACTTAC
VK00016-5CCGGGAAATAGGATGGTGGAAAATGCGAGGAAAAGCGGGCTGGGAAATAT
TAACGGCATTTTTAGTGAACGGCACGCAGACAAAGGATAAGAAGAGCGGC
ATGCCACCGCAGCATATTATTTGCCCGTCTGGGTCCTAATTGAATGTTGC
ACGTAAAATATTGGAAGGAAAGTGAGTTGGGTTCATTGCGGGGTCACCAA
ACGTGAGCTGAGGAGCACATATGTATATACATACATACATGTATGCTTAA
CACATTTTGATTGCATTAACAACGGGTGTCGAAAATAATTATAAATGTAA
TGCCACAAGACATAGACAGATATGCATTAGATTAA