Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00015

VK Genotype FlyBase Record BDSC Stock #
VK00015y[1] w[1118]; PBac{y[+]-attP}VK000159734

CytoSite Location (R5) Strand
:

Flanking sequence(s):
VK00015-3TTAATTATGATTCTTATGAGCAAGGTTCCCCTCATGGGCCACCAATGAAT
AGTTGTGATGCCTCACTGCTTTGACATCATTGTAATGGGGTTCGCAAATA
AGAATCATATATACACTATTTAACTTCATTTATTTTTTCATATACAAAAA
TCACGTCTGATCGCTATGACCGCAAAATTACAAGAGCGAAAGAAAGAATA
CAGTTCAGTTCAATTAGCATCGATATATAAAATGTTAATCCGCTGTTAAG
ACAGCTGAAGCACCGG
VK00015-5GATCAAATTTCGACATTGTTTATACTGACGTTGCTCCACTGTATGTAATA
TGCACAAATGCTCGTATGTNATCGGTGTTCTTCTTTGACGTCTTGTTTTT
TTGAGTTGGCAGAGATTCCGGCAAATCTAACGGAATCGAAGGGCAACGGG
ACTTAGCTCTGTCGTGATGAGAGCGAGCGCGAATGTTTGCGTATACTGCT
CTGTCGTGATGAGAGCGAGCGCGATAGAAAACGTAGGCACGGTGATTTAT
CTGGATGAAGCCGACCACGAAGATAAAATTGCCAAACAGCTTTTAGCAAT
TATTAA