Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00014

VK Genotype FlyBase Record BDSC Stock #
VK00014y[1] w[1118]; PBac{y[+]-attP}VK000149733

CytoSite Location (R5) Strand
43A12R : 7224205-

Flanking sequence(s):
VK00014-3TTAAGCTATAATAAAATGTTATCGCGCAGAAGAACCATCTTTCTCATCAA
AAACTCAACTACTTAGCACTACATGTTGTTCTCAGTGCACTGCAGTCAGT
GTACAATGTACAATGCAAACGGTAGGCTGTGGGGCACAAATTGTTGAATC
TAACAATGTAAGCAGGAACGAGGTTCCACTTGCCTCTGCGGCTCCTTGAC
CACCGCAAGTAGTGTGCCCCTTCGGAGTGGCCGGCATTATTTGCTAATTA
CGCCCTGTGGCAAGCGTTGCATGCATGTGATTGCTCTTATTCGACGGGTT
GCCAACCGGAGTACCTGCCCAGTGCCACCACCACTGCTCCAGTACCATCC
GAACCGATC
VK00014-5GATCTCCACTCGGAGTTCGGAGTGCGGAGGGCGAAAAACCCGGCCAACCC
CCCACTTTTGAGGTATTTTCCGTACGTCTGTGCGTTAGCGCCAAAGTCAT
TTGGCTTATCAATGCCAGACGCAGACTATTTCGGTGGCTTATCGGACTTT
TCCATCGCATTCCCGAAGCATGCAGGTGGCATTCGAGGGGCGGATGAGGA
CGGACCAGGATGCCAGCTGCCCCGGAGTGGGCGTTATTAAGTGGCCATTA
GTCCCGGCCAAACAAACTGGTGACAAACTGGACATGGAAGGGGTATGGCC
ACAAATTACACAGCTGCCAATGATTCGGCCGACTATCAGTCGCACACAGG
GAAATATAACTTTATTGATGCTATCTAAAGTCCTTTGACTGATTTCGGTG
TTCAGTTTATTATTCTTCCTTGGCAGGCATAATAAGTCATGGCTAAGCAA
GATACAAACGAAATACTAATAGCAACAAGACTGTATATGGTAATCCTCTT
AAAATATACATAAATATCAAGTGTATTAA