Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00013

VK Genotype FlyBase Record BDSC Stock #
VK00013y[1] w[1118]; PBac{y[+]-attP}VK000139732

CytoSite Location (R5) Strand
76A23L : 19204358-

Flanking sequence(s):
VK00013-3TTAAAATGGTGCGCGATTGGTTATTGGTTGGGAGCGATGTTGGTGTTTTG
GTCTTGTTAAAATGACGTCAAGGTATCCTGGAGAGATATTAAGACATATT
TTATAAGTGAGATC
VK00013-5TTCAACAACTGTTTCACGCCTTTCAATGATTCCTCCCCTGTTTCCCTTTA
AGCTGGCATGGAAAATCCATCAAAAGTACCCCGCTTCGTCTGCGAATTTT
CCGTGATACACACTTCGCTGAGATGTTTTTCATGCCATTTCAGACTTCCT
GTCTCTGTTCCAGCCTCGGTTTTTCTCTTTTTGCTTTCTGACCTAGGCCA
TCTTCTTCCCTTTTGCTCATTTCCGTCTGAACAACCGCTGACAGCTTAAT
GGCCGCCTTGCTCAAAAATTTAAAAATGAAGACGGGCTGGGGGGAAAGTA
TCTTTTTCATTTGAATATGGAGGAAAGTGCTCTTTGTAATCATTTGATTT
ACAGACCGCCAACGCGTCGCCCTCATCATCTCTTTGTGTCCATTTTCCAC
ACACACATTTTTCGCAATCTGCCAATGAAATTGTTTGTCAACGCATTAAT
TCTTCGCTGGCCAGTCTTATAATGATTTAATAAGCGATTTATTTATGCAT
TCGTTTGGCGATTGAAATGCTTTACATATCTCATGAATTCTTTCCGCTGA
TTGTGCAATTAATCAAGAGCTGAAAATGTGGAAAATTCAAAGCGAAATAT
TCGAAACTATGTTCTCTCCATCAGCGCCTAAAAAATATTTTCCCTCCACA
TATGCGGGCCCCAATTTATGGGAAATGGTCGAAATCGTTGAGTGCCTTTA
GATCAAAGTGAAGGCAAACGAATCGCCATCAATTCCTTCGATCCGTTGCT
AATGAGCTAAAATTGATTTTATTGAGTTTTCTTTTAA