Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00012

VK Genotype FlyBase Record BDSC Stock #
VK00012y[1] w[1118]; PBac{y[+]-attP}VK000129731

CytoSite Location (R5) Strand
25A32L : 4690634+

Flanking sequence(s):
VK00012-3TTAAATAAAAGTTAAATCAAGTCGCAACCAATTAGAAAAAAGGTCAAGGA
AAGCCACGAGTTTCCTGCGTCGTTGCCAGATGTTGGAATTCTGCACTTCC
ATTATACGCGTTAAAAGTGGAACAGTGGAAATGAACACGAGATTTGCCTT
CAATACCTGTTCTCCTTAAGCTCCTGTGTGAAAGCGTTATTATGAAATGC
AAAATTGTAGCTATGTGGCAACACCGTTGAAGGGAAGCACGTGAGAAACT
TATTAGCCAAATGATC
VK00012-5CCGGAAGGTCTTCCATTTCGTGAACATATAGCGAACGCACTCCATCCTCA
CTTCGTAATGAAGCATCTGGGTGTCGTACACCTGCTCAGCGACCACTCGA
AACAGACTCGAGGCATCCCCTAGCATATGCTTCCGAAAGAGTTGACGTCG
CTCCAGGAACCGATCTATTGGATCTCTTGCCTCTGTGGGAAGACTTGGTT
ATGGTAATTGTGTAAGATGCAAATCCCTGACCTACTTCTAACTTCAGTGG
AAGCTAAGCGCTGCAATACTTCGGACATTATTGTTGGGTAAAATATTTTA
GTACTGGGTACTTAA