Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00011

VK Genotype FlyBase Record BDSC Stock #
VK00011y[1] w[1118]; PBac{y[+]-attP}VK000119730

CytoSite Location (R5) Strand
40E42L : 22118584-

Flanking sequence(s):
VK00011-3AACTCTTATANTGGATTTGCATTTAAAGCTCCCCTTTTCCGAAGTCCTTG
GTTAGCAGGCAGTTGGTGTACAGCTTCGGGATAAGCATCAATGTAGTTTC
TTCTACGCGTGATTGGATACTCGGTAGACCGG
VK00011-5GATCGTATTGTGCACTTTTGGTATTCTAAGCGTCATGTATCATTTTTAGC
AGCATTGTAGATTTGAAGGTTTATGTTAGGCTGTTTAA