Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00010

VK Genotype FlyBase Record BDSC Stock #
VK00010y[1] w[1118]; PBac{y[+]-attP}VK000109729

CytoSite Location (R5) Strand
:

Flanking sequence(s):
VK00010-5GATCCTGTTTTAAATATAATATCCATTTTTAGCTTGTATCGGGTTCACCT
CTAGGCTTTGACCACGGACGGCACGGATGAAACATATTATAAGTGTTATT
ATGAACAACTGTTTAATCGGACTCCACTTGATTTTCGGGAGTTGAGCTGG
AATTGTATTTACTTTTATTAATTCTCTTTTGTTTTTTAAATTTAGATTTA
TAATGTCCAACTTTTCTTCCTCTATTTGTTTCTTCGTAATGTTTCTCATC
TATTTGTTGTACATGTCCTGTTTTCTTAAATGGGTTAGTTGTTTTACTTT
TTACCAATGGTGCTTGTTTATATCTAGTATCTACTTCATAGCTATGTCTA
TCTTTATTCAACTTATCTATTTTTGATTGTTTCTCTTTTTGGTGTCATAT
GCAGGTGTTCCTGCATAAAGGAAAATATCAGCTGGTGTTCTCCCAGTTGT
ATTGTGTTTAGTTTTGTGGTTATATACATAGAGAATAGTTTCAAATTGTG
TTATCTTATTTTCTGGGTCGGACTCACTATTAATGATTCTTAACTTTTCA
TTGACTGTTTTATGGAATCTTTCAATATCAGAAATTCCATTTTTACTTGT
TGTGATATTTATATTCACATTCTCGGACCTAAGCCATAAATGTAACGCGG
AACATATAAAAGCTGAATCTTTATCGGCCTTTATTTCGGACGGTTTTCCC
ATTTCATTGAAAATTTTAAGAAGAGCTCTTTTTGCTTCCAGCCAGTCTCT
ACTACTGACTTCAATCAAAGCGGCATATTTTGAATAAATGTCAATGCATG
ACAGGAACGCTTTTATTATTGATTAA