Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00008

VK Genotype FlyBase Record BDSC Stock #
VK00008y[1] w[1118]; PBac{y[+]-attP}VK000089728

CytoSite Location (R5) Strand
50A32R : 13378910+

Flanking sequence(s):
VK00008-3AACGTTTCAATGGATTGGTTTTAATGTATATTTTTAAGAAAGTATTGTAA
AAAATTATATATCTTGTTGTGATAACTTTATTATATTAGTACTAAGCCTA
CAGCAGATTCAAAGAAACTTGAAGAGCATTAGAAATGCGGTATGACGCTC
GATGCAGCGTCTACATTTCATGCATTGTTTGGAAGGAGTCCCAGTTTCCC
CCAGCAGAACTTAATTGTTTTCAATTAAAAACACTCACAGCCCATTCAGC
TAACGAATCCATTCGCTCGGCAGTTTTCATTCCGAGTATTCCCGTATTCA
TAGGCTCGAAGGCAGCGGCAGCGAAAGCCGG
VK00008-5GATCACTTCATTCACATGCTCACATGCCACACCCACATCGATTGTTTCAC
TCAAACCAGTGGTGATTGCAATGCGAACATCCTGCTCGACAGCGTTGGAA
AATCATAAACAATAACCATTTCATGCCGGGGAAAACAACAACGAGCAGAG
AATCGGCCGGCAACAAGCATATCTGGTAACCAGTATATATGGCGCGATTT
TTAATTATCACTTTCGCATTCGCATTCGCATTTTGTATTCGAGTATTGTC
TGGCGCGAATACGACTCGTATCTATCCATCTACGGCGGCTCTATCACCGC
CATTTCCACCATTTCCACTTCCATTTGCATTTCTCCCCGAAACAAAGAAT
GCGAGTGGAACAATCCATCGAATGCTCAGCTTTTAGCTGAGATTCTTCTC
AGCGAGTAAATGTATCTTAA