Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00007

VK Genotype FlyBase Record BDSC Stock #
VK00007y[1] w[1118]; PBac{y[+]-attP}VK000079727

CytoSite Location (R5) Strand
82A13R : 4255651+

Flanking sequence(s):
VK00007-5CCGGATCGCACACGGGCAATGCATACCTGCCACCCAATTTCTAACTTTTG
AGCTTGGTTCCCAAATCTTAGCATTGAGTCCTCTGTTACAAGTGTTGTTA
TTAA