Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00006

VK Genotype FlyBase Record BDSC Stock #
VK00006y[1] w[1118] PBac{y[+]-attP}VK000069726

CytoSite Location (R5) Strand
19E7X : 21017546-

Flanking sequence(s):
VK00006-3TTAAGGTTTATAATTCCTGCCACCTTCTAAATATAAGAAATGTAATTGTT
TTTCAAGAGGGTTTCATCAATCGAATGTGTACTGTTAATGGAAAAGGGAA
GGAGAGGCAGGGAGAGAGCGCTGCACAAATTTACCGTTTGACACGCAGCC
AAAGCTAAAGACGAAGTAACGGGAACCGGAAAATGGGAAACACAATGCCC
AGACTTAGACCACCCGCCGCCTCTCCTTTTCCACCGCCAGTTCAGTCTCA
CTCCATCAGATC
VK00006-5GATCATTTCCGGACTATGTGGAGAGTTTAAAAAGAGTCAACGCCATAGTC
GATTATTTTAATTATTCCTTATTTGATATCACTGCCTTGGGAAAATATAC
ATAGATATGCGAGTAGAAAGTCGAATGCTTCCGAGAGTGCACATGTGCTC
CACCTAGCGCCTGATACATTAACTAGCAATATAACCTTAACAAAATTAAC
CAATTTAAAAGGTTTTGGGAAAGTACATATGTATATGGATACTTATAATC
AAATCAAAGTACCATTTTAATTTGTATAACATATGTTGTTCTTGTTGTGT
TAGAGAGTATTAATTGTACAGATAGGAAGACTGACAGCCAAGTGGACGGG
CATGGCAGTAGATAACAATATTAAAATGTTTTTAA