Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00005

VK Genotype FlyBase Record BDSC Stock #
VK00005y[1] w[1118]; PBac{y[+]-attP}VK000059725

CytoSite Location (R5) Strand
75A103L : 17952108-

Flanking sequence(s):
VK00005-3TTAAAATGTTCAGTTTTACGTTACTTTCGCTTTGGAGTGGTAAGATTTTG
GGTTTCACTTGATTTCATTTTCGTTTTGACTATCGTGCTGTAAAAATATT
TACTAAATTATATCGAAAGTATTTATATCATAATTAAATAAACAACAATT
TTATGTGTATAAATGCGCCACAAGGAAAATGTGTAAAAACAAAAACCGTC
AGCGGTGGCAAAAAAAAAAATGGAAAGAAAAGGAAAAATCTACAAAAAAT
ATTATATTCTTTTAAAATTTATGCAGCGTAAGGAAGCGATGGTTCCCCCA
AAAACCACGAAATTAACAAAAATTTCACACTTCAATAATTGACTCTATAT
ATACACGCCAGCATATGTACGTAAATAAAACGATTTTGGTGTCTGAGTAT
GTATGTCTGTATGTAGGTGTATGTAACATTGTCCGTAACTTTTACCCAAA
AAAAACGGCAGCAAAAAATTGTAATTGTGTAACTAAAAGTGAATATTTTA
TGTAAAAACTATCTCAGCATTGGGCGATC
VK00005-5CACTGGTCATCTCTTACAAGGGTGTATTAA