Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00003

VK Genotype FlyBase Record BDSC Stock #
VK00003y[1] w[1118]; PBac{y[+]-attP}VK00003a; PBac{y[+]-attP}VK00003b9724

CytoSite Location (R5) Strand
31B1;40A42L : 10227773;21806041+/-

Flanking sequence(s):
VK00003-3TTAAATACTTTTATATATAATGTCTAAATTCATTTTCTCTGCGTTTTAAA
GAAAAGACATACTGTAGAGGAACCCTACTGTTTTGGGATC
VK00003-5CCGGTACGACAGATCCATTAATTGATGTAAACGCAGCCGCCCCATGAGCT
CCATAGAACTCCATGTCAAGCGTCTTCGTTGCGTGCGGTGGGACTGCCAC
TTTTGGTCGATATCGTTATGATTTATGTTTGCCCGCTTTTTTATTTCGCA
CACACACTCTCATTTGCGTATATGAACGAACATTCAGACGGACAGATCGC
TGCTTTTCCTTTCACATAAGCCTAGCTTTCTAGCCTTCAGTCTTCGGCTA
CTGGCTATCAATCTCTTAA