Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00002

VK Genotype FlyBase Record BDSC Stock #
VK00002y[1] w[1118]; PBac{y[+]-attP}VK000029723

CytoSite Location (R5) Strand
28E72L : 8140897-

Flanking sequence(s):
VK00002-3TTAAGTAATAACGTTCCTATAGATCACTGTCCCGCTTACACACAATTGCA
CATGTCCCCATGACATGCACTGCGCTCAAACTATTAGTACCCCTTAGTAA
CTTAAGCCAAATTAAAAATAAGTTCATTAATATAAATAAAATAGTCAATT
TCCACTGTCCCGATTGAATAGAGAAACTTTATTTGTAAATTTTAAATGTC
GCCAAGGAACTCGCTAGATATACTAAACCAAAACCGATTGTAGCTCCCGA
AATCGCAACCATAAGTGGAATAATTAGATGCCAACAAAGGCTTTGTTTGC
TTACTGAATAAAGGTTGTCGTAATTTGATTTCTGTGTAATCTTGCACGAA
ACGGAATCATTACCTCAGACATAATTTGCCTGCAATTGCGGTGGTGCACT
TGTCTCGTGCAAGCGAAAAAATCAGTGCTCGAAAAAGCTTAGTGGATATA
CTCGTACATATACTATGAATCGTTTAGAGGGGTAGGTAAATCAGCGGGCT
GCGTTCGAAATTTATGAGTGACTCTGCGACGTATTTATCTTAAGCCATCG
TCAGTTGCATATTTTATGGCTATTTTAAACCACTCAATGTGGTAATCGGG
CGATAATCATTTAATAGTCGAGGTCGACGGTATCGATTAGCTTGATATCT
ATAACAAGAAAATATATATATAATAAGTTATCACGTAAGTAGAACATGAA
ATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGA
TAATCATGCGTCATTTTGACTCACGCGGTCGTTATAGTTCAAAATCAGTG
ACACTTA
VK00002-5ACAAATGCCATGGCATTTATACTGCGGCTAATGTCAAGATTTGGCTTTTT
ATGACACCCCCCTATGCAGCGCAGAAAAAAAACCCGATTCGGATTTAGAG
TGTGGATTAAGTTCGCTAAAAAAAAATCGTTAACTGACCTGTTTGTTTGC
CAGTTCCCCACATGGCTGTTGCCGTTTATTATGGGTTAATCAAACGGTTG
AACCATTAAAACTATATCTAGCCAAATTAAAGGCGGAAACCATTTGAGAG
CAATCAGTCGGTGCAATTACAATTTATAAGCCACGGCTTACCTTCTCCAG
TAGTTTCTTAAATAGCACTGGTTTTTTTTAAACTAACACTGATTTAATGA
AAGGACATTTGTGGTAAACATTCAAAAACATCTTTTTTATCACTAATAAT
TAATAATGCTGTTGCATGTTTGATTGCGGCTATCGCTTGTTTAGTTCGAC
AACTCAATCTACATCTTCAAGTCCAGTTCCACCTTCGATTCCAAGTGCGA
ATTTGCAAACCCGTTTATGGCGGTTCCGTTTTCAATTCTGCCGATATTAA
TTAGCATTCATCACAACCCATAACTTCTTGACGAGCGATACGTTT