Vectors/Reagents Docking Sites Libraries Duplications
  • Home
  • About
  • Protocols
  • Credits

Insertion VK00001

VK Genotype FlyBase Record BDSC Stock #
VK00001y[1] w[1118]; PBac{y[+]-attP}VK000019722

CytoSite Location (R5) Strand
59D32R : 23236182+

Flanking sequence(s):
VK00001-3TTAATAAAAATTGAATGAAATTTATGAAATATTCGCGCGATGTGCATAGA
AATGCGTTCTTCGGAGGGTGGGGGGTGGACCCACCCACCTGCAGTCTGAA
TGAATCTCAGCCGCGAATCGTTGATCTTCATTAGCGGAAACGCCGCCGTC
GCCGCTGCTGCCGG
VK00001-5CCGGATTTGGTGCGTCCCTTTTCTTTTTTTTTTTTTGCTCTTCGGCCAGA
TCCCGATGGTCGCGTGGTGCTCCTCCCACAGCCAGCCCATTTTTCTTGTG
CTTAA